Here is the engrailed cDNA sequence:

 

Here is genomic DNA sequence in the vicinity of engrailed:

 

Here is the alignment of these cDNA and genomic sequences when aligned using "Blast 2 sequences" at NCBI:

 

 

NCBI logo

Blast 2 Sequences results

PubMed

Entrez

BLAST

OMIM

Taxonomy

Structure

BLAST 2 SEQUENCES RESULTS VERSION BLASTN 2.2.2 [Dec-14-2001] Match: Mismatch: gap open: gap extension:
x_dropoff: expect: wordsize: Filter


Sequence 1

lcl|seq_1

Length

2408

(1 .. 2408)

Sequence 2

lcl|seq_2

Length

5040

(1 .. 5040)


NOTE:The statistics (bitscore and expect value) is calculated based on the size of nr database

NOTE:If protein translation is reversed, please repeat the search with reverse strand of the query sequence

Score = 2894 bits (1505), Expect = 0.0
Identities = 1505/1505 (100%)
Strand = Plus / Plus
Query: 1 tcgatgtgaacagacgtgcgtgtcggaacaacagttgcaaatcaaacacgaaagcataag 60 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 619 tcgatgtgaacagacgtgcgtgtcggaacaacagttgcaaatcaaacacgaaagcataag 678 Query: 61 ccaaacaaaaaacaccaaacagagaagagaatcagaagattctgagcaatcagaagaatc 120 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 679 ccaaacaaaaaacaccaaacagagaagagaatcagaagattctgagcaatcagaagaatc 738 Query: 121 agtggctcagtgtcaagtgacccagtgacaagtgtcttaagcgagttgcgatttagcacc 180 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 739 agtggctcagtgtcaagtgacccagtgacaagtgtcttaagcgagttgcgatttagcacc 798 Query: 181 aagtcgaaaccaatggccctggaggatcgctgcagtccacagtcagcgcccagccccatt 240 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 799 aagtcgaaaccaatggccctggaggatcgctgcagtccacagtcagcgcccagccccatt 858 Query: 241 accctacaaatgcagcatcttcaccaccagcaacagcagcagcagcaacagcagcagcaa 300 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 859 accctacaaatgcagcatcttcaccaccagcaacagcagcagcagcaacagcagcagcaa 918 Query: 301 atgcagcacctccaccagctgcagcaactgcagcagttgcaccaacagcaactggccgcc 360 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 919 atgcagcacctccaccagctgcagcaactgcagcagttgcaccaacagcaactggccgcc 978 Query: 361 ggtgtcttccaccatccggcaatggccttcgatgccgctgcagccgccgctgctgcagct 420 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 979 ggtgtcttccaccatccggcaatggccttcgatgccgctgcagccgccgctgctgcagct 1038 Query: 421 gctgctgcggccgcccacgctcatgctgctgcactgcagcagcgcctcagtggcagtgga 480 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 1039 gctgctgcggccgcccacgctcatgctgctgcactgcagcagcgcctcagtggcagtgga 1098 Query: 481 tcgcccgcatcctgctccacgcccgcctcgtccacgccgctgaccatcaaggaggaggaa 540 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 1099 tcgcccgcatcctgctccacgcccgcctcgtccacgccgctgaccatcaaggaggaggaa 1158 Query: 541 agcgactccgtgatcggtgacatgagtttccacaatcagacgcacaccaccaacgaggag 600 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 1159 agcgactccgtgatcggtgacatgagtttccacaatcagacgcacaccaccaacgaggag 1218 Query: 601 gaggaggcggaggaggatgacgacattgatgtggatgtggatgatacgtcggcgggcgga 660 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 1219 gaggaggcggaggaggatgacgacattgatgtggatgtggatgatacgtcggcgggcgga 1278 Query: 661 cgcctgccaccacccgcccaccagcagcagtcgacggccaagccctcgctggccttttcc 720 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 1279 cgcctgccaccacccgcccaccagcagcagtcgacggccaagccctcgctggccttttcc 1338 Query: 721 atctccaacatcctgagcgatcgtttcggagatgtccagaagccgggcaagtcgatggag 780 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 1339 atctccaacatcctgagcgatcgtttcggagatgtccagaagccgggcaagtcgatggag 1398 Query: 781 aaccaggccagcatattccgccccttcgaggcgagtcgttcccagactgccacgccctcc 840 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 1399 aaccaggccagcatattccgccccttcgaggcgagtcgttcccagactgccacgccctcc 1458 Query: 841 gcctttacaagagtggatctgctggagtttagccggcaacagcaggctgccgccgcagcc 900 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 1459 gcctttacaagagtggatctgctggagtttagccggcaacagcaggctgccgccgcagcc 1518 Query: 901 gctactgcggccatgatgctggaacgggccaacttccttaactgcttcaatccggctgcc 960 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 1519 gctactgcggccatgatgctggaacgggccaacttccttaactgcttcaatccggctgcc 1578 Query: 961 tatcccaggatacacgaggaaatcgtgcagagtcggctgcgcaggagtgcagccaatgcc 1020 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 1579 tatcccaggatacacgaggaaatcgtgcagagtcggctgcgcaggagtgcagccaatgcc 1638 Query: 1021 gtcatcccgccgcccatgagctccaagatgagcgatgccaatccagagaaatctgctctg 1080 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 1639 gtcatcccgccgcccatgagctccaagatgagcgatgccaatccagagaaatctgctctg 1698 Query: 1081 ggatccctgtgcaaggcggtctcgcagatcggacaacctgctgcccctacgatgacccaa 1140 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 1699 ggatccctgtgcaaggcggtctcgcagatcggacaacctgctgcccctacgatgacccaa 1758 Query: 1141 cctccgctgagtagcagtgccagcagcttggccagtccgccacccgcctccaatgcctcg 1200 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 1759 cctccgctgagtagcagtgccagcagcttggccagtccgccacccgcctccaatgcctcg 1818 Query: 1201 accattagcagcacctcttccgtggccaccagctcgagctcctcctcgtcgggttgctcc 1260 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 1819 accattagcagcacctcttccgtggccaccagctcgagctcctcctcgtcgggttgctcc 1878 Query: 1261 tcggcggccagttccttgaactcctcgcccagtagccgactgggagccagtggatccgga 1320 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 1879 tcggcggccagttccttgaactcctcgcccagtagccgactgggagccagtggatccgga 1938 Query: 1321 gtcaatgccagcagtccccagccgcagccaatcccgccgccatccgccgttagccgagat 1380 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 1939 gtcaatgccagcagtccccagccgcagccaatcccgccgccatccgccgttagccgagat 1998 Query: 1381 tccggaatggagtcctcggatgacacgcgttccgagacgggatccaccaccacagagggc 1440 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 1999 tccggaatggagtcctcggatgacacgcgttccgagacgggatccaccaccacagagggc 2058 Query: 1441 ggcaagaacgagatgtggcccgcctgggtgtactgcacccgctacagcgatcgtcccagc 1500 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 2059 ggcaagaacgagatgtggcccgcctgggtgtactgcacccgctacagcgatcgtcccagc 2118 Query: 1501 tcagg 1505 ||||| Sbjct: 2119 tcagg 2123

Score = 1536 bits (799), Expect = 0.0
Identities = 801/802 (99%)
Strand = Plus / Plus
Query: 1601 agcgggagttcaacgagaatcgctatctgaccgagcggagacgccagcagctgagcagcg 1660 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 3632 agcgggagttcaacgagaatcgctatctgaccgagcggagacgccagcagctgagcagcg 3691 Query: 1661 agttgggcctgaacgaggcgcagatcaagatctggttccagaacaagcgggccaagatca 1720 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 3692 agttgggcctgaacgaggcgcagatcaagatctggttccagaacaagcgggccaagatca 3751 Query: 1721 agaagtcgacgggctccaaaaatccgctggcactgcagctgatggcccagggattgtaca 1780 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 3752 agaagtcgacgggctccaaaaatccgctggcactgcagctgatggcccagggattgtaca 3811 Query: 1781 accacaccaccgtgccgctgaccaaggaggaggaggagctcgagatgcgcatgaacgggc 1840 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 3812 accacaccaccgtgccgctgaccaaggaggaggaggagctcgagatgcgcatgaacgggc 3871 Query: 1841 agatcccctaagcgctgaccaatggttacccataaggggttactccttctgacgggggcg 1900 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 3872 agatcccctaagcgctgaccaatggttacccataaggggttactccttctgacgggggcg 3931 Query: 1901 tgcaatattcgagggcgtacaaatggttttcatgtgatataattgtagcgtacatatgtt 1960 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 3932 tgcaatattcgagggcgtacaaatggttttcatgtgatataattgtagcgtacatatgtt 3991 Query: 1961 tttgtatatatctctaaaaatatatatatatatacgtataatcctaacctagagtaagac 2020 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 3992 tttgtatatatctctaaaaatatatatatatatacgtataatcctaacctagagtaagac 4051 Query: 2021 ccatccgtagcgaattcgagctgtaagttgttggcgtatttatttaaccacccctggata 2080 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 4052 ccatccgtagcgaattcgagctgtaagttgttggcgtatttatttaaccacccctggata 4111 Query: 2081 gccgaaagtattatcgtaatcacccgacacaaagcctatcgctatcgccgcacttcaaaa 2140 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 4112 gccgaaagtattatcgtaatcacccgacacaaagcctatcgctatcgccgcacttcaaaa 4171 Query: 2141 gcttcgaccttcagacgtttattcctacacaaaacactatctatagttattactccctat 2200 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 4172 gcttcgaccttcagacgtttattcctacacaaaacactatctatagttattactccctat 4231 Query: 2201 aaattacgcgcttgcaaccgctctgtaaattaagtaacttaacagttccctagcttaatt 2260 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 4232 aaattacgcgcttgcaaccgctctgtaaattaagtaacttaacagttccctagcttaatt 4291 Query: 2261 cctagtttacacacttaaggattgctatgaaagagtattttagtttctaagcgaaatgtt 2320 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 4292 cctagtttacacacttaaggattgctatgaaagagtattttagtttctaagcgaaatgtt 4351 Query: 2321 aacgagcaactaatagctggcaaatgcacctaagaaaataacaacgaaatgtttgtgcta 2380 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 4352 aacgagcaactaatagctggcaaatgcacctaagaaaataacaacgaaatgtttgtgcta 4411 Query: 2381 aagcaagttcatgaaaaaaaaa 2402 ||||||||||||||||| |||| Sbjct: 4412 aagcaagttcatgaaaagaaaa 4433

Score =  194 bits (101), Expect = 2e-46
Identities = 101/101 (100%)
Strand = Plus / Plus
Query: 1502 caggaccccgctaccgccgccccaaacagccaaaggacaagaccaacgacgagaagcgtc 1561 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 3253 caggaccccgctaccgccgccccaaacagccaaaggacaagaccaacgacgagaagcgtc 3312 Query: 1562 cacgcaccgcgttctccagcgagcagttggcccgccttaag 1602 ||||||||||||||||||||||||||||||||||||||||| Sbjct: 3313 cacgcaccgcgttctccagcgagcagttggcccgccttaag 3353 CPU time: 0.08 user secs. 0.02 sys. secs 0.10 total secs. Gapped Lambda K H 1.33 0.621 1.12 Gapped Lambda K H 1.33 0.621 1.12 Matrix: blastn matrix:1 -2 Gap Penalties: Existence: 5, Extension: 2 Number of Hits to DB: 58 Number of Sequences: 0 Number of extensions: 58 Number of successful extensions: 24 Number of sequences better than 10.0: 1 length of query: 2408 length of database: 4,597,704,364 effective HSP length: 25 effective length of query: 2383 effective length of database: 4,594,561,339 effective search space: 10948839670837 effective search space used: 10948839670837 T: 0 A: 30 X1: 6 (11.5 bits) X2: 26 (50.0 bits) S1: 12 (23.8 bits) S2: 21 (41.1 bits)