<html xmlns:v="urn:schemas-microsoft-com:vml" xmlns:o="urn:schemas-microsoft-com:office:office" xmlns:w="urn:schemas-microsoft-com:office:word" xmlns:m="http://schemas.microsoft.com/office/2004/12/omml" xmlns:mv="http://macVmlSchemaUri" xmlns="http://www.w3.org/TR/REC-html40"> <!--This file created 1/7/03 10:18 AM by Claris Home Page version 3.0--> <head> <meta name=Title content="EST_assembly"> <meta name=Keywords content=""> <meta http-equiv=Content-Type content="text/html; charset=unicode"> <meta name=ProgId content=Word.Document> <meta name=Generator content="Microsoft Word 14"> <meta name=Originator content="Microsoft Word 14"> <link rel=File-List href="est_assembly_lab_files/filelist.xml"> <link rel=Edit-Time-Data href="est_assembly_lab_files/editdata.mso"> <!--[if !mso]> <style> v\:* {behavior:url(#default#VML);} o\:* {behavior:url(#default#VML);} w\:* {behavior:url(#default#VML);} .shape {behavior:url(#default#VML);} </style> <![endif]--> <title>EST_assembly</title> <!--[if gte mso 9]><xml> <o:DocumentProperties> <o:Template>Normal</o:Template> <o:LastAuthor>Michael Weir</o:LastAuthor> <o:Revision>6</o:Revision> <o:TotalTime>11</o:TotalTime> <o:Created>2015-04-30T17:43:00Z</o:Created> <o:LastSaved>2015-04-30T18:22:00Z</o:LastSaved> <o:Pages>2</o:Pages> <o:Words>1037</o:Words> <o:Characters>5915</o:Characters> <o:Lines>49</o:Lines> <o:Paragraphs>13</o:Paragraphs> <o:CharactersWithSpaces>6939</o:CharactersWithSpaces> <o:Version>14.0</o:Version> </o:DocumentProperties> <o:OfficeDocumentSettings> <o:AllowPNG/> </o:OfficeDocumentSettings> </xml><![endif]--> <link rel=themeData href="est_assembly_lab_files/themedata.xml"> <!--[if gte mso 9]><xml> <w:WordDocument> <w:Zoom>150</w:Zoom> <w:SpellingState>Clean</w:SpellingState> <w:GrammarState>Clean</w:GrammarState> <w:TrackMoves/> <w:TrackFormatting/> <w:ValidateAgainstSchemas/> <w:SaveIfXMLInvalid>false</w:SaveIfXMLInvalid> <w:IgnoreMixedContent>false</w:IgnoreMixedContent> <w:AlwaysShowPlaceholderText>false</w:AlwaysShowPlaceholderText> <w:DoNotPromoteQF/> <w:LidThemeOther>EN-US</w:LidThemeOther> <w:LidThemeAsian>X-NONE</w:LidThemeAsian> <w:LidThemeComplexScript>X-NONE</w:LidThemeComplexScript> <w:Compatibility> <w:SplitPgBreakAndParaMark/> </w:Compatibility> <m:mathPr> <m:mathFont m:val="Cambria Math"/> <m:brkBin m:val="before"/> <m:brkBinSub m:val="&#45;-"/> <m:smallFrac m:val="off"/> <m:dispDef/> <m:lMargin m:val="0"/> <m:rMargin m:val="0"/> <m:defJc m:val="centerGroup"/> <m:wrapIndent m:val="1440"/> <m:intLim m:val="subSup"/> <m:naryLim m:val="undOvr"/> </m:mathPr></w:WordDocument> </xml><![endif]--><!--[if gte mso 9]><xml> <w:LatentStyles DefLockedState="false" DefUnhideWhenUsed="true" DefSemiHidden="true" DefQFormat="false" DefPriority="99" LatentStyleCount="276"> <w:LsdException Locked="false" Priority="0" SemiHidden="false" UnhideWhenUsed="false" QFormat="true" Name="Normal"/> <w:LsdException Locked="false" Priority="9" SemiHidden="false" UnhideWhenUsed="false" QFormat="true" Name="heading 1"/> <w:LsdException Locked="false" Priority="9" QFormat="true" Name="heading 2"/> <w:LsdException Locked="false" Priority="9" QFormat="true" Name="heading 3"/> <w:LsdException Locked="false" Priority="9" QFormat="true" Name="heading 4"/> <w:LsdException Locked="false" Priority="9" QFormat="true" Name="heading 5"/> <w:LsdException Locked="false" Priority="9" QFormat="true" Name="heading 6"/> <w:LsdException Locked="false" Priority="9" QFormat="true" Name="heading 7"/> <w:LsdException Locked="false" Priority="9" QFormat="true" Name="heading 8"/> <w:LsdException Locked="false" Priority="9" QFormat="true" Name="heading 9"/> <w:LsdException Locked="false" Priority="39" Name="toc 1"/> <w:LsdException Locked="false" Priority="39" Name="toc 2"/> <w:LsdException Locked="false" Priority="39" Name="toc 3"/> <w:LsdException Locked="false" Priority="39" Name="toc 4"/> <w:LsdException Locked="false" Priority="39" Name="toc 5"/> <w:LsdException Locked="false" Priority="39" Name="toc 6"/> <w:LsdException Locked="false" Priority="39" Name="toc 7"/> <w:LsdException Locked="false" Priority="39" Name="toc 8"/> <w:LsdException Locked="false" Priority="39" Name="toc 9"/> <w:LsdException Locked="false" Priority="35" QFormat="true" Name="caption"/> <w:LsdException Locked="false" Priority="10" SemiHidden="false" UnhideWhenUsed="false" QFormat="true" Name="Title"/> <w:LsdException Locked="false" Priority="1" Name="Default Paragraph Font"/> <w:LsdException Locked="false" Priority="11" SemiHidden="false" UnhideWhenUsed="false" QFormat="true" Name="Subtitle"/> <w:LsdException Locked="false" Priority="22" SemiHidden="false" UnhideWhenUsed="false" QFormat="true" Name="Strong"/> <w:LsdException Locked="false" Priority="20" SemiHidden="false" UnhideWhenUsed="false" QFormat="true" Name="Emphasis"/> <w:LsdException Locked="false" Priority="59" SemiHidden="false" UnhideWhenUsed="false" Name="Table Grid"/> <w:LsdException Locked="false" UnhideWhenUsed="false" Name="Placeholder Text"/> <w:LsdException Locked="false" Priority="1" SemiHidden="false" UnhideWhenUsed="false" QFormat="true" Name="No Spacing"/> <w:LsdException Locked="false" Priority="60" SemiHidden="false" UnhideWhenUsed="false" Name="Light Shading"/> <w:LsdException Locked="false" Priority="61" SemiHidden="false" UnhideWhenUsed="false" Name="Light List"/> <w:LsdException Locked="false" Priority="62" SemiHidden="false" UnhideWhenUsed="false" Name="Light Grid"/> <w:LsdException Locked="false" Priority="63" SemiHidden="false" UnhideWhenUsed="false" Name="Medium Shading 1"/> <w:LsdException Locked="false" Priority="64" SemiHidden="false" UnhideWhenUsed="false" Name="Medium Shading 2"/> <w:LsdException Locked="false" Priority="65" SemiHidden="false" UnhideWhenUsed="false" Name="Medium List 1"/> <w:LsdException Locked="false" Priority="66" SemiHidden="false" UnhideWhenUsed="false" Name="Medium List 2"/> <w:LsdException Locked="false" Priority="67" SemiHidden="false" UnhideWhenUsed="false" Name="Medium Grid 1"/> <w:LsdException Locked="false" Priority="68" SemiHidden="false" UnhideWhenUsed="false" Name="Medium Grid 2"/> <w:LsdException Locked="false" Priority="69" SemiHidden="false" UnhideWhenUsed="false" Name="Medium Grid 3"/> <w:LsdException Locked="false" Priority="70" SemiHidden="false" UnhideWhenUsed="false" Name="Dark List"/> <w:LsdException Locked="false" Priority="71" SemiHidden="false" UnhideWhenUsed="false" Name="Colorful Shading"/> <w:LsdException Locked="false" Priority="72" SemiHidden="false" UnhideWhenUsed="false" Name="Colorful List"/> <w:LsdException Locked="false" Priority="73" SemiHidden="false" UnhideWhenUsed="false" Name="Colorful Grid"/> <w:LsdException Locked="false" Priority="60" SemiHidden="false" UnhideWhenUsed="false" Name="Light Shading Accent 1"/> <w:LsdException Locked="false" Priority="61" SemiHidden="false" UnhideWhenUsed="false" Name="Light List Accent 1"/> <w:LsdException Locked="false" Priority="62" SemiHidden="false" UnhideWhenUsed="false" Name="Light Grid Accent 1"/> <w:LsdException Locked="false" Priority="63" SemiHidden="false" UnhideWhenUsed="false" Name="Medium Shading 1 Accent 1"/> <w:LsdException Locked="false" Priority="64" SemiHidden="false" UnhideWhenUsed="false" Name="Medium Shading 2 Accent 1"/> <w:LsdException Locked="false" Priority="65" SemiHidden="false" UnhideWhenUsed="false" Name="Medium List 1 Accent 1"/> <w:LsdException Locked="false" UnhideWhenUsed="false" Name="Revision"/> <w:LsdException Locked="false" Priority="34" SemiHidden="false" UnhideWhenUsed="false" QFormat="true" Name="List Paragraph"/> <w:LsdException Locked="false" Priority="29" SemiHidden="false" UnhideWhenUsed="false" QFormat="true" Name="Quote"/> <w:LsdException Locked="false" Priority="30" SemiHidden="false" UnhideWhenUsed="false" QFormat="true" Name="Intense Quote"/> <w:LsdException Locked="false" Priority="66" SemiHidden="false" UnhideWhenUsed="false" Name="Medium List 2 Accent 1"/> <w:LsdException Locked="false" Priority="67" SemiHidden="false" UnhideWhenUsed="false" Name="Medium Grid 1 Accent 1"/> <w:LsdException Locked="false" Priority="68" SemiHidden="false" UnhideWhenUsed="false" Name="Medium Grid 2 Accent 1"/> <w:LsdException Locked="false" Priority="69" SemiHidden="false" UnhideWhenUsed="false" Name="Medium Grid 3 Accent 1"/> <w:LsdException Locked="false" Priority="70" SemiHidden="false" UnhideWhenUsed="false" Name="Dark List Accent 1"/> <w:LsdException Locked="false" Priority="71" SemiHidden="false" UnhideWhenUsed="false" Name="Colorful Shading Accent 1"/> <w:LsdException Locked="false" Priority="72" SemiHidden="false" UnhideWhenUsed="false" Name="Colorful List Accent 1"/> <w:LsdException Locked="false" Priority="73" SemiHidden="false" UnhideWhenUsed="false" Name="Colorful Grid Accent 1"/> <w:LsdException Locked="false" Priority="60" SemiHidden="false" UnhideWhenUsed="false" Name="Light Shading Accent 2"/> <w:LsdException Locked="false" Priority="61" SemiHidden="false" UnhideWhenUsed="false" Name="Light List Accent 2"/> <w:LsdException Locked="false" Priority="62" SemiHidden="false" UnhideWhenUsed="false" Name="Light Grid Accent 2"/> <w:LsdException Locked="false" Priority="63" SemiHidden="false" UnhideWhenUsed="false" Name="Medium Shading 1 Accent 2"/> <w:LsdException Locked="false" Priority="64" SemiHidden="false" UnhideWhenUsed="false" Name="Medium Shading 2 Accent 2"/> <w:LsdException Locked="false" Priority="65" SemiHidden="false" UnhideWhenUsed="false" Name="Medium List 1 Accent 2"/> <w:LsdException Locked="false" Priority="66" SemiHidden="false" UnhideWhenUsed="false" Name="Medium List 2 Accent 2"/> <w:LsdException Locked="false" Priority="67" SemiHidden="false" UnhideWhenUsed="false" Name="Medium Grid 1 Accent 2"/> <w:LsdException Locked="false" Priority="68" SemiHidden="false" UnhideWhenUsed="false" Name="Medium Grid 2 Accent 2"/> <w:LsdException Locked="false" Priority="69" SemiHidden="false" UnhideWhenUsed="false" Name="Medium Grid 3 Accent 2"/> <w:LsdException Locked="false" Priority="70" SemiHidden="false" UnhideWhenUsed="false" Name="Dark List Accent 2"/> <w:LsdException Locked="false" Priority="71" SemiHidden="false" UnhideWhenUsed="false" Name="Colorful Shading Accent 2"/> <w:LsdException Locked="false" Priority="72" SemiHidden="false" UnhideWhenUsed="false" Name="Colorful List Accent 2"/> <w:LsdException Locked="false" Priority="73" SemiHidden="false" UnhideWhenUsed="false" Name="Colorful Grid Accent 2"/> <w:LsdException Locked="false" Priority="60" SemiHidden="false" UnhideWhenUsed="false" Name="Light Shading Accent 3"/> <w:LsdException Locked="false" Priority="61" SemiHidden="false" UnhideWhenUsed="false" Name="Light List Accent 3"/> <w:LsdException Locked="false" Priority="62" SemiHidden="false" UnhideWhenUsed="false" Name="Light Grid Accent 3"/> <w:LsdException Locked="false" Priority="63" SemiHidden="false" UnhideWhenUsed="false" Name="Medium Shading 1 Accent 3"/> <w:LsdException Locked="false" Priority="64" SemiHidden="false" UnhideWhenUsed="false" Name="Medium Shading 2 Accent 3"/> <w:LsdException Locked="false" Priority="65" SemiHidden="false" UnhideWhenUsed="false" Name="Medium List 1 Accent 3"/> <w:LsdException Locked="false" Priority="66" SemiHidden="false" UnhideWhenUsed="false" Name="Medium List 2 Accent 3"/> <w:LsdException Locked="false" Priority="67" SemiHidden="false" UnhideWhenUsed="false" Name="Medium Grid 1 Accent 3"/> <w:LsdException Locked="false" Priority="68" SemiHidden="false" UnhideWhenUsed="false" Name="Medium Grid 2 Accent 3"/> <w:LsdException Locked="false" Priority="69" SemiHidden="false" UnhideWhenUsed="false" Name="Medium Grid 3 Accent 3"/> <w:LsdException Locked="false" Priority="70" SemiHidden="false" UnhideWhenUsed="false" Name="Dark List Accent 3"/> <w:LsdException Locked="false" Priority="71" SemiHidden="false" UnhideWhenUsed="false" Name="Colorful Shading Accent 3"/> <w:LsdException Locked="false" Priority="72" SemiHidden="false" UnhideWhenUsed="false" Name="Colorful List Accent 3"/> <w:LsdException Locked="false" Priority="73" SemiHidden="false" UnhideWhenUsed="false" Name="Colorful Grid Accent 3"/> <w:LsdException Locked="false" Priority="60" SemiHidden="false" UnhideWhenUsed="false" Name="Light Shading Accent 4"/> <w:LsdException Locked="false" Priority="61" SemiHidden="false" UnhideWhenUsed="false" Name="Light List Accent 4"/> <w:LsdException Locked="false" Priority="62" SemiHidden="false" UnhideWhenUsed="false" Name="Light Grid Accent 4"/> <w:LsdException Locked="false" Priority="63" SemiHidden="false" UnhideWhenUsed="false" Name="Medium Shading 1 Accent 4"/> <w:LsdException Locked="false" Priority="64" SemiHidden="false" UnhideWhenUsed="false" Name="Medium Shading 2 Accent 4"/> <w:LsdException Locked="false" Priority="65" SemiHidden="false" UnhideWhenUsed="false" Name="Medium List 1 Accent 4"/> <w:LsdException Locked="false" Priority="66" SemiHidden="false" UnhideWhenUsed="false" Name="Medium List 2 Accent 4"/> <w:LsdException Locked="false" Priority="67" SemiHidden="false" UnhideWhenUsed="false" Name="Medium Grid 1 Accent 4"/> <w:LsdException Locked="false" Priority="68" SemiHidden="false" UnhideWhenUsed="false" Name="Medium Grid 2 Accent 4"/> <w:LsdException Locked="false" Priority="69" SemiHidden="false" UnhideWhenUsed="false" Name="Medium Grid 3 Accent 4"/> <w:LsdException Locked="false" Priority="70" SemiHidden="false" UnhideWhenUsed="false" Name="Dark List Accent 4"/> <w:LsdException Locked="false" Priority="71" SemiHidden="false" UnhideWhenUsed="false" Name="Colorful Shading Accent 4"/> <w:LsdException Locked="false" Priority="72" SemiHidden="false" UnhideWhenUsed="false" Name="Colorful List Accent 4"/> <w:LsdException Locked="false" Priority="73" SemiHidden="false" UnhideWhenUsed="false" Name="Colorful Grid Accent 4"/> <w:LsdException Locked="false" Priority="60" SemiHidden="false" UnhideWhenUsed="false" Name="Light Shading Accent 5"/> <w:LsdException Locked="false" Priority="61" SemiHidden="false" UnhideWhenUsed="false" Name="Light List Accent 5"/> <w:LsdException Locked="false" Priority="62" SemiHidden="false" UnhideWhenUsed="false" Name="Light Grid Accent 5"/> <w:LsdException Locked="false" Priority="63" SemiHidden="false" UnhideWhenUsed="false" Name="Medium Shading 1 Accent 5"/> <w:LsdException Locked="false" Priority="64" SemiHidden="false" UnhideWhenUsed="false" Name="Medium Shading 2 Accent 5"/> <w:LsdException Locked="false" Priority="65" SemiHidden="false" UnhideWhenUsed="false" Name="Medium List 1 Accent 5"/> <w:LsdException Locked="false" Priority="66" SemiHidden="false" UnhideWhenUsed="false" Name="Medium List 2 Accent 5"/> <w:LsdException Locked="false" Priority="67" SemiHidden="false" UnhideWhenUsed="false" Name="Medium Grid 1 Accent 5"/> <w:LsdException Locked="false" Priority="68" SemiHidden="false" UnhideWhenUsed="false" Name="Medium Grid 2 Accent 5"/> <w:LsdException Locked="false" Priority="69" SemiHidden="false" UnhideWhenUsed="false" Name="Medium Grid 3 Accent 5"/> <w:LsdException Locked="false" Priority="70" SemiHidden="false" UnhideWhenUsed="false" Name="Dark List Accent 5"/> <w:LsdException Locked="false" Priority="71" SemiHidden="false" UnhideWhenUsed="false" Name="Colorful Shading Accent 5"/> <w:LsdException Locked="false" Priority="72" SemiHidden="false" UnhideWhenUsed="false" Name="Colorful List Accent 5"/> <w:LsdException Locked="false" Priority="73" SemiHidden="false" UnhideWhenUsed="false" Name="Colorful Grid Accent 5"/> <w:LsdException Locked="false" Priority="60" SemiHidden="false" UnhideWhenUsed="false" Name="Light Shading Accent 6"/> <w:LsdException Locked="false" Priority="61" SemiHidden="false" UnhideWhenUsed="false" Name="Light List Accent 6"/> <w:LsdException Locked="false" Priority="62" SemiHidden="false" UnhideWhenUsed="false" Name="Light Grid Accent 6"/> <w:LsdException Locked="false" Priority="63" SemiHidden="false" UnhideWhenUsed="false" Name="Medium Shading 1 Accent 6"/> <w:LsdException Locked="false" Priority="64" SemiHidden="false" UnhideWhenUsed="false" Name="Medium Shading 2 Accent 6"/> <w:LsdException Locked="false" Priority="65" SemiHidden="false" UnhideWhenUsed="false" Name="Medium List 1 Accent 6"/> <w:LsdException Locked="false" Priority="66" SemiHidden="false" UnhideWhenUsed="false" Name="Medium List 2 Accent 6"/> <w:LsdException Locked="false" Priority="67" SemiHidden="false" UnhideWhenUsed="false" Name="Medium Grid 1 Accent 6"/> <w:LsdException Locked="false" Priority="68" SemiHidden="false" UnhideWhenUsed="false" Name="Medium Grid 2 Accent 6"/> <w:LsdException Locked="false" Priority="69" SemiHidden="false" UnhideWhenUsed="false" Name="Medium Grid 3 Accent 6"/> <w:LsdException Locked="false" Priority="70" SemiHidden="false" UnhideWhenUsed="false" Name="Dark List Accent 6"/> <w:LsdException Locked="false" Priority="71" SemiHidden="false" UnhideWhenUsed="false" Name="Colorful Shading Accent 6"/> <w:LsdException Locked="false" Priority="72" SemiHidden="false" UnhideWhenUsed="false" Name="Colorful List Accent 6"/> <w:LsdException Locked="false" Priority="73" SemiHidden="false" UnhideWhenUsed="false" Name="Colorful Grid Accent 6"/> <w:LsdException Locked="false" Priority="19" SemiHidden="false" UnhideWhenUsed="false" QFormat="true" Name="Subtle Emphasis"/> <w:LsdException Locked="false" Priority="21" SemiHidden="false" UnhideWhenUsed="false" QFormat="true" Name="Intense Emphasis"/> <w:LsdException Locked="false" Priority="31" SemiHidden="false" UnhideWhenUsed="false" QFormat="true" Name="Subtle Reference"/> <w:LsdException Locked="false" Priority="32" SemiHidden="false" UnhideWhenUsed="false" QFormat="true" Name="Intense Reference"/> <w:LsdException Locked="false" Priority="33" SemiHidden="false" UnhideWhenUsed="false" QFormat="true" Name="Book Title"/> <w:LsdException Locked="false" Priority="37" Name="Bibliography"/> <w:LsdException Locked="false" Priority="39" QFormat="true" Name="TOC Heading"/> </w:LatentStyles> </xml><![endif]--> <style> <!-- /* Font Definitions */ @font-face {font-family:"Courier New"; panose-1:2 7 3 9 2 2 5 2 4 4; mso-font-charset:0; mso-generic-font-family:auto; mso-font-pitch:variable; mso-font-signature:-536859905 -1073711037 9 0 511 0;} @font-face {font-family:Times; panose-1:2 0 5 0 0 0 0 0 0 0; mso-font-charset:0; mso-generic-font-family:auto; mso-font-pitch:variable; mso-font-signature:3 0 0 0 1 0;} @font-face {font-family:"-3 fg"; mso-font-charset:78; mso-generic-font-family:auto; mso-font-pitch:variable; mso-font-signature:-536870145 1791491579 18 0 131231 0;} @font-face {font-family:"-3 fg"; mso-font-charset:78; mso-generic-font-family:auto; mso-font-pitch:variable; mso-font-signature:-536870145 1791491579 18 0 131231 0;} /* Style Definitions */ p.MsoNormal, li.MsoNormal, div.MsoNormal {mso-style-unhide:no; mso-style-qformat:yes; mso-style-parent:""; mso-margin-top-alt:auto; margin-right:0in; mso-margin-bottom-alt:auto; margin-left:0in; mso-pagination:widow-orphan; font-size:10.0pt; font-family:Times; mso-fareast-font-family:"-3 fg"; mso-fareast-theme-font:minor-fareast; mso-bidi-font-family:"Times New Roman"; mso-bidi-theme-font:minor-bidi;} a:link, span.MsoHyperlink {mso-style-noshow:yes; mso-style-priority:99; color:blue; text-decoration:underline; text-underline:single;} a:visited, span.MsoHyperlinkFollowed {mso-style-noshow:yes; mso-style-priority:99; color:blue; text-decoration:underline; text-underline:single;} p {mso-style-noshow:yes; mso-style-priority:99; mso-margin-top-alt:auto; margin-right:0in; mso-margin-bottom-alt:auto; margin-left:0in; mso-pagination:widow-orphan; font-size:10.0pt; font-family:Times; mso-fareast-font-family:"-3 fg"; mso-fareast-theme-font:minor-fareast; mso-bidi-font-family:"Times New Roman";} p.MsoListParagraph, li.MsoListParagraph, div.MsoListParagraph {mso-style-priority:34; mso-style-unhide:no; mso-style-qformat:yes; mso-margin-top-alt:auto; margin-right:0in; mso-margin-bottom-alt:auto; margin-left:.5in; mso-add-space:auto; mso-pagination:widow-orphan; font-size:10.0pt; font-family:Times; mso-fareast-font-family:"-3 fg"; mso-fareast-theme-font:minor-fareast; mso-bidi-font-family:"Times New Roman"; mso-bidi-theme-font:minor-bidi;} p.MsoListParagraphCxSpFirst, li.MsoListParagraphCxSpFirst, div.MsoListParagraphCxSpFirst {mso-style-priority:34; mso-style-unhide:no; mso-style-qformat:yes; mso-style-type:export-only; mso-margin-top-alt:auto; margin-right:0in; mso-margin-bottom-alt:auto; margin-left:.5in; mso-add-space:auto; mso-pagination:widow-orphan; font-size:10.0pt; font-family:Times; mso-fareast-font-family:"-3 fg"; mso-fareast-theme-font:minor-fareast; mso-bidi-font-family:"Times New Roman"; mso-bidi-theme-font:minor-bidi;} p.MsoListParagraphCxSpMiddle, li.MsoListParagraphCxSpMiddle, div.MsoListParagraphCxSpMiddle {mso-style-priority:34; mso-style-unhide:no; mso-style-qformat:yes; mso-style-type:export-only; mso-margin-top-alt:auto; margin-right:0in; mso-margin-bottom-alt:auto; margin-left:.5in; mso-add-space:auto; mso-pagination:widow-orphan; font-size:10.0pt; font-family:Times; mso-fareast-font-family:"-3 fg"; mso-fareast-theme-font:minor-fareast; mso-bidi-font-family:"Times New Roman"; mso-bidi-theme-font:minor-bidi;} p.MsoListParagraphCxSpLast, li.MsoListParagraphCxSpLast, div.MsoListParagraphCxSpLast {mso-style-priority:34; mso-style-unhide:no; mso-style-qformat:yes; mso-style-type:export-only; mso-margin-top-alt:auto; margin-right:0in; mso-margin-bottom-alt:auto; margin-left:.5in; mso-add-space:auto; mso-pagination:widow-orphan; font-size:10.0pt; font-family:Times; mso-fareast-font-family:"-3 fg"; mso-fareast-theme-font:minor-fareast; mso-bidi-font-family:"Times New Roman"; mso-bidi-theme-font:minor-bidi;} span.SpellE {mso-style-name:""; mso-spl-e:yes;} span.GramE {mso-style-name:""; mso-gram-e:yes;} .MsoChpDefault {mso-style-type:export-only; mso-default-props:yes; font-size:10.0pt; mso-ansi-font-size:10.0pt; mso-bidi-font-size:10.0pt;} @page WordSection1 {size:8.5in 11.0in; margin:1.0in 1.25in 1.0in 1.25in; mso-header-margin:.5in; mso-footer-margin:.5in; mso-paper-source:0;} div.WordSection1 {page:WordSection1;} /* List Definitions */ @list l0 {mso-list-id:16583920; mso-list-type:hybrid; mso-list-template-ids:-389403824 -410610898 -970952606 -991151684 1531472230 -367505944 996705348 -1470038408 97009038 -151984600;} @list l0:level1 {mso-level-tab-stop:.5in; mso-level-number-position:left; text-indent:-.25in;} @list l0:level2 {mso-level-tab-stop:1.0in; mso-level-number-position:left; text-indent:-.25in;} @list l0:level3 {mso-level-tab-stop:1.5in; mso-level-number-position:left; text-indent:-.25in;} @list l0:level4 {mso-level-tab-stop:2.0in; mso-level-number-position:left; text-indent:-.25in;} @list l0:level5 {mso-level-tab-stop:2.5in; mso-level-number-position:left; text-indent:-.25in;} @list l0:level6 {mso-level-tab-stop:3.0in; mso-level-number-position:left; text-indent:-.25in;} @list l0:level7 {mso-level-tab-stop:3.5in; mso-level-number-position:left; text-indent:-.25in;} @list l0:level8 {mso-level-tab-stop:4.0in; mso-level-number-position:left; text-indent:-.25in;} @list l0:level9 {mso-level-tab-stop:4.5in; mso-level-number-position:left; text-indent:-.25in;} @list l1 {mso-list-id:413092441; mso-list-template-ids:8571744;} @list l1:level1 {mso-level-number-format:bullet; mso-level-text:; mso-level-tab-stop:.5in; mso-level-number-position:left; text-indent:-.25in; mso-ansi-font-size:10.0pt; font-family:Symbol;} @list l1:level2 {mso-level-number-format:bullet; mso-level-text:o; mso-level-tab-stop:1.0in; mso-level-number-position:left; text-indent:-.25in; mso-ansi-font-size:10.0pt; font-family:"Courier New"; mso-bidi-font-family:"Times New Roman";} @list l1:level3 {mso-level-number-format:bullet; mso-level-text:; mso-level-tab-stop:1.5in; mso-level-number-position:left; text-indent:-.25in; mso-ansi-font-size:10.0pt; font-family:Symbol;} @list l1:level4 {mso-level-number-format:bullet; mso-level-text:; mso-level-tab-stop:2.0in; mso-level-number-position:left; text-indent:-.25in; mso-ansi-font-size:10.0pt; font-family:Symbol;} @list l1:level5 {mso-level-number-format:bullet; mso-level-text:; mso-level-tab-stop:2.5in; mso-level-number-position:left; text-indent:-.25in; mso-ansi-font-size:10.0pt; font-family:Symbol;} @list l1:level6 {mso-level-number-format:bullet; mso-level-text:; mso-level-tab-stop:3.0in; mso-level-number-position:left; text-indent:-.25in; mso-ansi-font-size:10.0pt; font-family:Symbol;} @list l1:level7 {mso-level-number-format:bullet; mso-level-text:; mso-level-tab-stop:3.5in; mso-level-number-position:left; text-indent:-.25in; mso-ansi-font-size:10.0pt; font-family:Symbol;} @list l1:level8 {mso-level-number-format:bullet; mso-level-text:; mso-level-tab-stop:4.0in; mso-level-number-position:left; text-indent:-.25in; mso-ansi-font-size:10.0pt; font-family:Symbol;} @list l1:level9 {mso-level-number-format:bullet; mso-level-text:; mso-level-tab-stop:4.5in; mso-level-number-position:left; text-indent:-.25in; mso-ansi-font-size:10.0pt; font-family:Symbol;} @list l2 {mso-list-id:1167523992; mso-list-template-ids:-523459714;} @list l3 {mso-list-id:1337734124; mso-list-template-ids:941501278;} @list l4 {mso-list-id:1567455434; mso-list-type:hybrid; mso-list-template-ids:1745001692 1408272294 1429874780 -673699216 2072926172 628377410 1114944442 1463713710 -772239200 -927566816;} @list l4:level1 {mso-level-number-format:bullet; mso-level-text:; mso-level-tab-stop:.5in; mso-level-number-position:left; text-indent:-.25in; mso-ansi-font-size:10.0pt; mso-bidi-font-size:10.0pt; font-family:Symbol;} @list l4:level2 {mso-level-number-format:bullet; mso-level-text:o; mso-level-tab-stop:1.0in; mso-level-number-position:left; text-indent:-.25in; mso-ansi-font-size:10.0pt; mso-bidi-font-size:10.0pt; font-family:"Courier New";} @list l4:level3 {mso-level-tab-stop:1.5in; mso-level-number-position:left; text-indent:-.25in;} @list l4:level4 {mso-level-tab-stop:2.0in; mso-level-number-position:left; text-indent:-.25in;} @list l4:level5 {mso-level-tab-stop:2.5in; mso-level-number-position:left; text-indent:-.25in;} @list l4:level6 {mso-level-tab-stop:3.0in; mso-level-number-position:left; text-indent:-.25in;} @list l4:level7 {mso-level-tab-stop:3.5in; mso-level-number-position:left; text-indent:-.25in;} @list l4:level8 {mso-level-tab-stop:4.0in; mso-level-number-position:left; text-indent:-.25in;} @list l4:level9 {mso-level-tab-stop:4.5in; mso-level-number-position:left; text-indent:-.25in;} @list l5 {mso-list-id:1992170326; mso-list-type:hybrid; mso-list-template-ids:-949458380 -1192053628 -818016678 -203771576 -1942041262 1300897416 -1243710198 -2088351838 1858475634 -2111646666;} @list l5:level1 {mso-level-tab-stop:.5in; mso-level-number-position:left; text-indent:-.25in;} @list l5:level2 {mso-level-tab-stop:1.0in; mso-level-number-position:left; text-indent:-.25in;} @list l5:level3 {mso-level-tab-stop:1.5in; mso-level-number-position:left; text-indent:-.25in;} @list l5:level4 {mso-level-tab-stop:2.0in; mso-level-number-position:left; text-indent:-.25in;} @list l5:level5 {mso-level-tab-stop:2.5in; mso-level-number-position:left; text-indent:-.25in;} @list l5:level6 {mso-level-tab-stop:3.0in; mso-level-number-position:left; text-indent:-.25in;} @list l5:level7 {mso-level-tab-stop:3.5in; mso-level-number-position:left; text-indent:-.25in;} @list l5:level8 {mso-level-tab-stop:4.0in; mso-level-number-position:left; text-indent:-.25in;} @list l5:level9 {mso-level-tab-stop:4.5in; mso-level-number-position:left; text-indent:-.25in;} --> </style> <!--[if gte mso 10]> <style> /* Style Definitions */ table.MsoNormalTable {mso-style-name:"Table Normal"; mso-tstyle-rowband-size:0; mso-tstyle-colband-size:0; mso-style-noshow:yes; mso-style-priority:99; mso-style-parent:""; mso-padding-alt:0in 5.4pt 0in 5.4pt; mso-para-margin:0in; mso-para-margin-bottom:.0001pt; mso-pagination:widow-orphan; font-size:10.0pt; font-family:"Times New Roman";} </style> <![endif]--><X-CLARIS-WINDOW TOP=84 BOTTOM=762 LEFT=389 RIGHT=1057><X-CLARIS-TAGVIEW MODE=minimal><!--[if gte mso 9]><xml> <o:shapedefaults v:ext="edit" spidmax="1027"/> </xml><![endif]--><!--[if gte mso 9]><xml> <o:shapelayout v:ext="edit"> <o:idmap v:ext="edit" data="1"/> </o:shapelayout></xml><![endif]--> </head> <body bgcolor=white lang=EN-US link=blue vlink=blue style='tab-interval:.5in'> <div class=WordSection1> <p class=MsoNormal align=center style='margin:0in;margin-bottom:.0001pt; text-align:center'><b><span style='font-size:13.5pt;mso-bidi-font-family:"Times New Roman"; color:red'>&nbsp;EST Sequence Assembly</span></b><span style='mso-bidi-font-family: "Times New Roman"'> <o:p></o:p></span></p> <p align=center style='text-align:center'><b><span style='font-size:12.0pt; color:black'>BIOL 265/COMP 113 Computer Laboratory</span></b></p> <p align=center style='text-align:center'><b><span style='font-size:12.0pt; color:black'>M. Weir / M. Rice / D. <span class=SpellE>Krizanc</span></span></b></p> <div class=MsoNormal align=center style='margin:0in;margin-bottom:.0001pt; text-align:center'><span style='mso-fareast-font-family:"Times New Roman"; mso-bidi-font-family:"Times New Roman"'> <hr size=2 width="100%" align=center> </span></div> <p class=MsoNormal style='margin:0in;margin-bottom:.0001pt'><span style='mso-bidi-font-family:"Times New Roman"'>Assembly of long DNA or RNA sequences from overlapping shorter sequences is a computational challenge for biologists. For example, an important component of the genome projects <span class=GramE>is</span> to assemble mRNA sequence information for all genes. One approach towards this goal is to systematically sequence large numbers of <span class=SpellE>cDNAs</span> from <span class=SpellE>cDNA</span> libraries (cDNAs are DNA copies of mRNAs).<o:p></o:p></span></p> <p>High quality sequence runs are typically about 500 <span class=SpellE>bp</span>, whereas mRNAs are typically longer.</p> <p>Therefore it is necessary to perform computational analysis of <span class=SpellE>cDNA</span> sequences to identify overlaps and thereby predict larger sequence fragments of mRNAs. <span class=GramE>This analysis can be complicated by issues including the possibility of alternative splicing and sequence duplications</span>.</p> <div class=MsoNormal align=center style='margin:0in;margin-bottom:.0001pt; text-align:center'><span style='mso-fareast-font-family:"Times New Roman"; mso-bidi-font-family:"Times New Roman"'> <hr size=2 width="100%" align=center> </span></div> <p class=MsoNormal style='margin:0in;margin-bottom:.0001pt'><span style='mso-bidi-font-family:"Times New Roman"'>We have assembled several Drosophila sequence segments with overlapping sequence -- an example of the kind of data that might emerge from this type of analysis.<o:p></o:p></span></p> <p><span style='font-size:13.5pt'>S1</span></p> <p><span style='font-size:13.5pt'><TEXTAREA NAME="S1" ROWS="10" COLS="100" WRAP="physical">GCGAGTCGTTCCCAGACTGCCACGCCCTCCGCCTTTACAAGAGTGGATCTGCTGGAGTTTAGCCGGCAACAGCAGGCTGCCGCCGCAGCCGCTACTGCGGCCATGATGCTGGAACGGGCCAACTTCCTTAACTGCTTCAATCCGGCTGCCTATCCCAGGATACACGAGGAAATCGTGCAGAGTCGGCTGCGCAGGAGTGCAGCCAATGCCGTCATCCCGCCGCCCATGAGCTCCAAGATGAGCGATGCCAATCCAGAGAAATCTGCTCTGGGATCCCTGTGCAAGGCGGTCTCGCAGATCGGACAACCTGCTGCCCCTACGATGACCCAACCTCCGCTGAGTAGCAGTGCCAGCAGCTTGGCCAGTCCGCCACCCGCCTCCAATGCCTCGACCATTAGCAGCACCTCTTCCGTGGCCACCAGCTCGAGCTCCTCCTCGTCGGGTTGCTCCTCGGCGGCCAGTTCCTTGAACTCCTCGCCCAGTAGCCGACTGGGAGCCAGTGGATCCGGAGTCAATGCCAGCAGTCCCCAGCCGCAGCCA</TEXTAREA> <span style="mso-spacerun:yes"> </span></span></p> <p><span style='font-size:13.5pt'>S2</span></p> <p><span style='font-size:13.5pt'><TEXTAREA NAME="S2" ROWS="10" COLS="100" WRAP="physical">CCGTGGCCACCAGCTCGAGCTCCTCCTCGTCGGGTTGCTCCTCGGCGGCCAGTTCCTTGAACTCCTCGCCCAGTAGCCGACTGGGAGCCAGTGGATCCGGAGTCAATGCCAGCAGTCCCCAGCCGCAGCCAATCCCGCCGCCATCCGCCGTTAGCCGAGATTCCGGAATGGAGTCCTCGGATGACACGCGTTCCGAGACGGGATCCACCACCACAGAGGGCGGCAAGAACGAGATGTGGCCCGCCTGGGTGTACTGCACCCGCTACAGCGATCGTCCCAGCTCAGGACCCCGCTACCGCCGCCCCAAACAGCCAAAGGACAAGACCAACGACGAGAAGCGTCCACGCACCGCGTTCTCCAGCGAGCAGTTGGCCCGCCTTAAGCGGGAGTTCAACGAGAATCGCTATCTGACCGAGCGGAGACGCCAGCAGCTGAGCAGCGAGTTGGGCCTGAACGAGGCGCAGATCAAGATCTGGTTCCAGAACAAGCGGGCCAAGATCAAGAAGTCGA</TEXTAREA> <span style="mso-spacerun:yes"> </span></span></p> <p><span style='font-size:13.5pt'>S3</span></p> <p><span style='font-size:13.5pt'><TEXTAREA NAME="S3" ROWS="10" COLS="100" WRAP="physical">TGACCATCAAGGAGGAGGAAAGCGACTCCGTGATCGGTGACATGAGTTTCCACAATCAGACGCACACCACCAACGAGGAGGAGGAGGCGGAGGAGGATGACGACATTGATGTGGATGTGGATGATACGTCGGCGGGCGGACGCCTGCCACCACCCGCCCACCAGCAGCAGTCGACGGCCAAGCCCTCGCTGGCCTTTTCCATCTCCAACATCCTGAGCGATCGTTTCGGAGATGTCCAGAAGCCGGGCAAGTCGATGGAGAACCAGGCCAGCATATTCCGCCCCTTCGAGGCGAGTCGTTCCCAGACTGCCACGCCCTCCGCCTTTACAAGAGTGGATCTGCTGGAGTTTAGCCGGCAACAGCAGGCTGCCGCCGCAGCCGCTACTGCGGCCATGATGCTGGAACGGGCCAACTTCCTTAACTGCTTCAATCCGGCTGCCTATCCCAGGATACACGAGGAAATCGTGCAGAGTCGGCTGC</TEXTAREA> <span style="mso-spacerun:yes"> </span></span></p> <p><span style='font-size:13.5pt'>S4</span></p> <p><span style='font-size:13.5pt'><TEXTAREA NAME="S4" ROWS="10" COLS="100" WRAP="virtual">CTGAACGAGGCGCAGATCAAGATCTGGTTCCAGAACAAACGGGCCAAGCTGAAAAAGTCGAGCGGCACCAAGAATCCGCTGGCGCTGCAGCTGATGGCGCAGGGATTGTACAACCACTCGACGATACCGCTGACCCGCGAGGAGGAGGAGCTGCAGGAGCTGCAGGAGGCGGCTAGTGCCGCTGCCGCCAAGGAGCCCTGCTAGAAGGAGGTGGGGTGTGCGGCAATATCTACAATCTAGTATTTATGGAGTAGTGTGTAAGCTAGCTTTAGAAATTCTGAGCGATTAAGTTGTACAATATTCTAGTCCGCCGCACACGCAGTCGAACGCAGAATCAGGTGAAGAAATCTTCCGGAGAATTGGCCGCTGGGCGTAGAAATCCCCCGAAGAGCTATGATTGTGTGTGCGTTTTGTATAATAGATTCATAAATTCACAACTAAATAATTTAATAAACATTTAAATTATACA</TEXTAREA> <span style="mso-spacerun:yes"> </span></span></p> <div class=MsoNormal align=center style='margin:0in;margin-bottom:.0001pt; text-align:center'><span style='mso-fareast-font-family:"Times New Roman"; mso-bidi-font-family:"Times New Roman"'> <hr size=2 width="100%" align=center> </span></div> <span style='font-size:10.0pt;font-family:Times;mso-fareast-font-family:"Times New Roman"; mso-bidi-font-family:"Times New Roman";mso-ansi-language:EN-US;mso-fareast-language: EN-US;mso-bidi-language:AR-SA'> <ol start=1 type=1> <li class=MsoNormal style='margin-bottom:12.0pt;mso-list:l5 level1 lfo3; tab-stops:list .5in'><span style='mso-fareast-font-family:"Times New Roman"; mso-bidi-font-family:"Times New Roman"'>Use the <a href="https://blast.ncbi.nlm.nih.gov/Blast.cgi?PAGE=MegaBlast&PROGRAM=blastn&BLAST_PROGRAMS=megaBlast&PAGE_TYPE=BlastSearch&BLAST_SPEC=blast2seq&DATABASE=n/a&QUERY=&SUBJECTS=">&quot;BLAST 2 sequences&quot;</a> server to determine the regions of overlap between these four sequences (use FASTA format entering &gt;<span class=SpellE>sequencename</span> in the line above the sequence).<span style="mso-spacerun:yes"> </span>Record (e.g. with screen shots) the BLAST alignments of the overlap regions. (Notice that the alignment results are distributed over several lines as the sequences are quite long.)<o:p></o:p></span></li> <li class=MsoNormal style='margin-bottom:12.0pt;mso-list:l5 level1 lfo3; tab-stops:list .5in'><span style='mso-fareast-font-family:"Times New Roman"; mso-bidi-font-family:"Times New Roman"'>Draw a line diagram that illustrates the regions of overlap between the four sequences (S1, S2, S3, S4) showing the overlap coordinates for both sequences of each overlap.<span style="mso-spacerun:yes"> </span>This is analogous to constructing a <span class=SpellE>contig</span> from the four sequences.<o:p></o:p></span></li> <li class=MsoNormal style='margin-bottom:12.0pt;mso-list:l5 level1 lfo3; tab-stops:list .5in'><span style='mso-fareast-font-family:"Times New Roman"; mso-bidi-font-family:"Times New Roman"'>Based on your alignments in questions 1 and 2, define a set of string slices of S1, S2, S3 and S4 which when concatenated together (in the correct order) create a contig representing the composite cDNA segment (remember Python string indices start at 0 whereas BLAST outputs start counting at 1). Be sure that the overlapping sequences are only included once. Using Python, run your concatenation to create the contig sequence.<o:p></o:p></span></li> <li class=MsoNormal style='margin-bottom:12.0pt;mso-list:l5 level1 lfo3; tab-stops:list .5in'><span style='mso-fareast-font-family:"Times New Roman"; mso-bidi-font-family:"Times New Roman"'>Notice that the overlap between two of the sequences contains some mismatches: what are three possible explanations for this? Think about how the sequence information is obtained as well as biological processes that might be involved. (Might the overlap with mismatches be misleading us?) <o:p></o:p></span></li> <li class=MsoNormal style='margin-bottom:12.0pt;mso-list:l5 level1 lfo3; tab-stops:list .5in'><span style='mso-fareast-font-family:"Times New Roman"; mso-bidi-font-family:"Times New Roman"'>To resolve this issue, and assess whether the composite <span class=SpellE>cDNA</span> represents a real mRNA, it is useful to compare the composite <span class=SpellE>cDNA</span> with Drosophila genomic sequence. Go to the Drosophila <a href="http://flybase.net/blast/"><span class=SpellE>Flybase</span> BLAST server</a>. Use your composite <span class=SpellE>cDNA</span> as a query against the whole <span class=SpellE>euchromatic</span> genome sequence (i.e. choose the Genome Section &quot;Genome Assembly (NT)&quot;). Use the program <span class=SpellE>Blastn</span> <span class=SpellE>nt</span>-&gt;NT.<o:p></o:p></span></li> <li class=MsoNormal style='margin-bottom:12.0pt;mso-list:l5 level1 lfo3; tab-stops:list .5in'><span style='mso-fareast-font-family:"Times New Roman"; mso-bidi-font-family:"Times New Roman"'>Does your output allow you to distinguish between the possible explanations for the mismatches (step 4 above)<span class=GramE>.</span> Discuss the orientations of your <span class=SpellE>cDNA</span> fragments. (Assume that all the <span class=SpellE>cDNA</span> sequences correspond to the mRNA single strand sequences, not the antisense sequences.) Develop a model (an explanation) to explain all the results of your BLAST search.<o:p></o:p></span></li> <li class=MsoNormal style='margin-bottom:12.0pt;mso-list:l5 level1 lfo3; tab-stops:list .5in'><span style='mso-fareast-font-family:"Times New Roman"; mso-bidi-font-family:"Times New Roman"'>To test your model, perform a BLAST search with the composite <span class=SpellE>cDNA</span> (input) against the dataset of predicted Drosophila genes (using Database &quot;Annotated Genes (NT)&quot; on <a href="http://flybase.net/blast/"><span class=SpellE>Flybase</span> BLAST server</a>). Does the BLAST search confirm your model?<o:p></o:p></span></li> <li class=MsoNormal style='margin-bottom:12.0pt;mso-list:l5 level1 lfo3; tab-stops:list .5in'><span style='mso-fareast-font-family:"Times New Roman"; mso-bidi-font-family:"Times New Roman"'>Use the BLAST result to link to matching predicted gene(s). <o:p></o:p></span></li> <li class=MsoNormal style='mso-list:l5 level1 lfo3;tab-stops:list .5in'><span style='mso-fareast-font-family:"Times New Roman";mso-bidi-font-family: "Times New Roman"'>View the genes in the &quot;<span class=GramE>Map(</span><span class=SpellE>GBrowse</span>)&quot; link (on the LHS of the gene report). This will facilitate assessing your model. You may find it useful to reduce the scale of the map (e.g. change to &quot;show 100 <span class=SpellE>kbp</span>&quot;) in order to see neighboring genes. Notice that the Gene Region Map can show several maps based on your choices in the  select tracks tab: <o:p></o:p></span></li> </ol> <ul type=disc> <ul type=circle> <li class=MsoNormal style='mso-list:l4 level2 lfo6;tab-stops:list 1.0in'><span style='mso-fareast-font-family:"Times New Roman";mso-bidi-font-family: "Times New Roman"'>DNA sequence map (we are looking at 7M on chromosome 2R) <o:p></o:p></span></li> <li class=MsoNormal style='mso-list:l4 level2 lfo6;tab-stops:list 1.0in'><span class=SpellE><span class=GramE><span style='mso-fareast-font-family:"Times New Roman"; mso-bidi-font-family:"Times New Roman"'>cytologic</span></span></span><span style='mso-fareast-font-family:"Times New Roman";mso-bidi-font-family: "Times New Roman"'> map showing chromosome band names (&quot;<span class=SpellE>cytologic</span> band&quot;; we are in the region of band 47F17) <o:p></o:p></span></li> <li class=MsoNormal style='mso-list:l4 level2 lfo6;tab-stops:list 1.0in'><span class=GramE><span style='mso-fareast-font-family:"Times New Roman"; mso-bidi-font-family:"Times New Roman"'>mutation</span></span><span style='mso-fareast-font-family:"Times New Roman";mso-bidi-font-family: "Times New Roman"'> map (&quot;<span class=SpellE>point_mutation</span>&quot;) <o:p></o:p></span></li> <li class=MsoNormal style='mso-list:l4 level2 lfo6;tab-stops:list 1.0in'><span class=GramE><span style='mso-fareast-font-family:"Times New Roman"; mso-bidi-font-family:"Times New Roman"'>gene</span></span><span style='mso-fareast-font-family:"Times New Roman";mso-bidi-font-family: "Times New Roman"'> model map (&quot;Gene span&quot;; notice the genes <i>en</i> and <span class=SpellE><i>inv</i></span>) <o:p></o:p></span></li> <li class=MsoNormal style='mso-list:l4 level2 lfo6;tab-stops:list 1.0in'><span class=GramE><span style='mso-fareast-font-family:"Times New Roman"; mso-bidi-font-family:"Times New Roman"'>predicted</span></span><span style='mso-fareast-font-family:"Times New Roman";mso-bidi-font-family: "Times New Roman"'> gene map (e.g. &quot;<span class=SpellE>Genescan</span> prediction&quot;) <o:p></o:p></span></li> <li class=MsoNormal style='mso-list:l4 level2 lfo6;tab-stops:list 1.0in'><span class=GramE><span style='mso-fareast-font-family:"Times New Roman"; mso-bidi-font-family:"Times New Roman"'>mRNA</span></span><span style='mso-fareast-font-family:"Times New Roman";mso-bidi-font-family: "Times New Roman"'> map (&quot;mRNA&quot;) <o:p></o:p></span></li> <li class=MsoNormal style='mso-list:l4 level2 lfo6;tab-stops:list 1.0in'><span class=GramE><span style='mso-fareast-font-family:"Times New Roman"; mso-bidi-font-family:"Times New Roman"'>protein</span></span><span style='mso-fareast-font-family:"Times New Roman";mso-bidi-font-family: "Times New Roman"'> coding sequence map (&quot;CDS&quot;) <o:p></o:p></span></li> <li class=MsoNormal style='mso-list:l4 level2 lfo6;tab-stops:list 1.0in'><span style='mso-fareast-font-family:"Times New Roman";mso-bidi-font-family: "Times New Roman"'>DNA maps referring to DNA clones used in the sequence assembly (&quot;Tiling BAC&quot;) <o:p></o:p></span></li> <li class=MsoNormal style='mso-list:l4 level2 lfo6;tab-stops:list 1.0in'><span class=GramE><span style='mso-fareast-font-family:"Times New Roman"; mso-bidi-font-family:"Times New Roman"'>sequenced</span></span><span style='mso-fareast-font-family:"Times New Roman";mso-bidi-font-family: "Times New Roman"'> <span class=SpellE>cDNA</span> clones (&quot;<span class=SpellE>cDNA</span> and other aligned sequences&quot;) <o:p></o:p></span></li> <li class=MsoNormal style='mso-list:l4 level2 lfo6;tab-stops:list 1.0in'><span class=GramE><span style='mso-fareast-font-family:"Times New Roman"; mso-bidi-font-family:"Times New Roman"'>microarray</span></span><span style='mso-fareast-font-family:"Times New Roman";mso-bidi-font-family: "Times New Roman"'> probes (&quot;<span class=SpellE>Affymetrix</span> v1 or v2&quot;) <o:p></o:p></span></li> </ul> </ul> </span> <div class=MsoNormal align=center style='margin:0in;margin-bottom:.0001pt; text-align:center'><span style='mso-fareast-font-family:"Times New Roman"; mso-bidi-font-family:"Times New Roman"'> <hr size=2 width="100%" align=center> </span></div> <p class=MsoNormal style='margin:0in;margin-bottom:.0001pt'><span style='mso-bidi-font-family:"Times New Roman"'>This analysis provides indications of the kinds of issues that arise during sequence assembly -- of genomic and mRNA sequences. It is wise to try to confirm interpretations using independent data -- in this case, comparing <span class=SpellE>cDNA</span> and genomic sequences.<o:p></o:p></span></p> <div class=MsoNormal align=center style='margin:0in;margin-bottom:.0001pt; text-align:center'><span style='mso-fareast-font-family:"Times New Roman"; mso-bidi-font-family:"Times New Roman"'> <hr size=2 width="100%" align=center> </span></div> <p class=MsoNormal style='margin:0in;margin-bottom:.0001pt'><b><span style='mso-bidi-font-family:"Times New Roman";color:red'>Assignment:</span></b><span style='mso-bidi-font-family:"Times New Roman"'><o:p></o:p></span></p> <p class=MsoNormal style='margin-bottom:12.0pt'><span style='mso-fareast-font-family: "Times New Roman";mso-bidi-font-family:"Times New Roman"'>Answer questions 3, 4, 6 and 7 above. <o:p></o:p></span></p> <div class=MsoNormal align=center style='margin-bottom:12.0pt;text-align:center'><span style='mso-fareast-font-family:"Times New Roman";mso-bidi-font-family:"Times New Roman"'> <hr size=2 width="100%" align=center> </span></div> <p class=MsoNormal style='margin:0in;margin-bottom:.0001pt'><b><span style='mso-bidi-font-family:"Times New Roman";color:red'>Additional challenges (not part of assignment):</span></b><span style='mso-bidi-font-family:"Times New Roman"'><o:p></o:p></span></p> <ol start=1 type=1> <li class=MsoNormal style='margin-bottom:12.0pt;mso-list:l0 level1 lfo9; tab-stops:list .5in'><span style='mso-fareast-font-family:"Times New Roman"; mso-bidi-font-family:"Times New Roman"'>Using artificial sequence constructs (using S1, S2, S3, S4), determine a way to deduce ALL overlaps between these four sequences using a SINGLE call of the <a href="http://www.ncbi.nlm.nih.gov/blast/bl2seq/wblast2.cgi">&quot;BLAST 2 sequences&quot;</a> server. Provide your input and output.<o:p></o:p></span></li> <li class=MsoNormal style='mso-list:l0 level1 lfo9;tab-stops:list .5in'><span style='mso-fareast-font-family:"Times New Roman";mso-bidi-font-family: "Times New Roman"'>Using Python, consider how you would design a prefix-suffix overlap detection function that takes two strings as input, and if the two strings overlap, output's the inferred combined sequence. You may consider an exact match or imprecise match version (without gaps). <o:p></o:p></span></li> </ol> <div class=MsoNormal align=center style='margin:0in;margin-bottom:.0001pt; text-align:center'><span style='mso-fareast-font-family:"Times New Roman"; mso-bidi-font-family:"Times New Roman"'> <hr size=2 width="100%" align=center> </span></div> <p class=MsoNormal style='margin:0in;margin-bottom:.0001pt'><span style='mso-bidi-font-family:"Times New Roman"'>Copyright 2018 Wesleyan University<o:p></o:p></span></p> </div> </body> </html>